Stem-loop sequence hsa-mir-6791

AccessionMI0022636 (change log)
Symbol HGNC:MIR6791
DescriptionHomo sapiens miR-6791 stem-loop
Literature search

1 open access papers mention hsa-mir-6791
(2 sentences)

Stem-loop
   ---  --     ccu     -u      -g    aa 
5'    cc  agacc   ggggc  gggcag  cgga  g
      ||  |||||   |||||  ||||||  ||||   
3'    gg  ucugg   cuccg  uccguc  gucu  a
   gac  cc     uuc     uc      aa    gg 
Get sequence
Deep sequencing
109 reads, 5.77 reads per million, 52 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 6736712-6736778 [-]
sense
OTTHUMT00000458011 ; GPR108-015; exon 1
OTTHUMT00000407518 ; GPR108-009; exon 1
OTTHUMT00000407508 ; GPR108-001; exon 2
OTTHUMT00000407511 ; GPR108-003; exon 2
OTTHUMT00000407512 ; GPR108-002; 5'UTR (exon 2)
OTTHUMT00000458008 ; GPR108-014; exon 2
OTTHUMT00000407514 ; GPR108-007; 5'UTR (exon 2)
OTTHUMT00000458010 ; GPR108-016; exon 2
OTTHUMT00000407515 ; GPR108-005; exon 2
OTTHUMT00000407516 ; GPR108-008; exon 2
OTTHUMT00000407517 ; GPR108-006; exon 2
ENST00000601402 ; GPR108-015; exon 1
ENST00000597043 ; GPR108-009; exon 1
ENST00000264080 ; GPR108-001; exon 2
ENST00000595908 ; GPR108-003; exon 2
ENST00000430424 ; GPR108-002; 5'UTR (exon 2)
ENST00000597706 ; GPR108-014; exon 2
ENST00000597298 ; GPR108-007; 5'UTR (exon 2)
ENST00000598052 ; GPR108-016; exon 2
ENST00000601716 ; GPR108-005; exon 2
ENST00000595108 ; GPR108-008; exon 2
ENST00000595620 ; GPR108-006; exon 2
Database links

Mature sequence hsa-miR-6791-5p

Accession MIMAT0027482
Sequence

6 - 

ccccuggggcugggcaggcgga

 - 27

Get sequence
Deep sequencing24 reads, 17 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6791-3p

Accession MIMAT0027483
Sequence

47 - 

ugccuccuuggucuccggcag

 - 67

Get sequence
Deep sequencing72 reads, 37 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).