Stem-loop sequence hsa-mir-6790

AccessionMI0022635 (change log)
Symbol HGNC:MIR6790
DescriptionHomo sapiens miR-6790 stem-loop
Gene family MIPF0001811; mir-6790
Stem-loop
   -       u  au   g      -----    g 
5'  gugagug gg  uug cggggu     ucgg g
    ||||||| ||  ||| ||||||     |||| g
3'  cacucac cc  agc gcucca     agcc u
   c       u  cc   g      gcggc    u 
Get sequence
Deep sequencing
39 reads, 0 reads per million, 25 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 6392921-6392983 [-]
sense
OTTHUMT00000398033 ; GTF2F1-001; intron 1
OTTHUMT00000398035 ; GTF2F1-005; intron 1
OTTHUMT00000398037 ; GTF2F1-003; intron 2
ENST00000394456 ; GTF2F1-001; intron 1
ENST00000595047 ; GTF2F1-005; intron 1
ENST00000598607 ; GTF2F1-003; intron 2
Clustered miRNAs
< 10kb from hsa-mir-6790
hsa-mir-6790chr19: 6392921-6392983 [-]
hsa-mir-6885chr19: 6389638-6389703 [-]
Database links

Mature sequence hsa-miR-6790-5p

Accession MIMAT0027480
Sequence

1 - 

gugaguguggauuuggcgggguu

 - 23

Get sequence
Deep sequencing22 reads, 17 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6790-3p

Accession MIMAT0027481
Sequence

39 - 

cgaccucggcgaccccucacu

 - 59

Get sequence
Deep sequencing9 reads, 6 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).