Stem-loop sequence hsa-mir-6789

AccessionMI0022634 (change log)
Symbol HGNC:MIR6789
DescriptionHomo sapiens miR-6789 stem-loop
Stem-loop
   cga  ua      ucc       g    -    ucc   gc     c  u     
5'    gg  ggggcg   cgggcgc cggg cggg   cag  ugggc cc cgga 
      ||  ||||||   ||||||| |||| ||||   |||  ||||| || ||| g
3'    cc  cucugu   gcccgcg gccc gccc   guc  acucg gg gccg 
   -ga  uc      ---       -    u    --c   --     u  -     
Get sequence
Deep sequencing
628 reads, 51.3 reads per million, 80 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 2235829-2235926 [-]
sense
OTTHUMT00000451262 ; PLEKHJ1-005; intron 1
OTTHUMT00000451263 ; PLEKHJ1-012; intron 1
OTTHUMT00000451252 ; PLEKHJ1-009; intron 2
OTTHUMT00000451259 ; PLEKHJ1-011; intron 2
OTTHUMT00000451260 ; PLEKHJ1-007; exon 2
OTTHUMT00000451254 ; PLEKHJ1-003; exon 2
OTTHUMT00000451261 ; PLEKHJ1-008; intron 2
OTTHUMT00000451256 ; PLEKHJ1-002; intron 2
OTTHUMT00000451264 ; PLEKHJ1-004; intron 2
OTTHUMT00000451255 ; PLEKHJ1-001; intron 3
ENST00000585423 ; PLEKHJ1-005; intron 1
ENST00000586497 ; PLEKHJ1-012; intron 1
ENST00000587394 ; PLEKHJ1-009; intron 2
ENST00000587962 ; PLEKHJ1-011; intron 2
ENST00000586608 ; PLEKHJ1-007; exon 2
ENST00000588450 ; PLEKHJ1-003; exon 2
ENST00000591099 ; PLEKHJ1-008; intron 2
ENST00000589791 ; PLEKHJ1-002; intron 2
ENST00000588356 ; PLEKHJ1-004; intron 2
ENST00000326631 ; PLEKHJ1-201; intron 2
ENST00000589097 ; PLEKHJ1-001; intron 3
Clustered miRNAs
< 10kb from hsa-mir-6789
hsa-mir-6789chr19: 2235829-2235926 [-]
hsa-mir-1227chr19: 2234062-2234149 [-]
Database links

Mature sequence hsa-miR-6789-5p

Accession MIMAT0027478
Sequence

5 - 

guaggggcgucccgggcgcgcggg

 - 28

Get sequence
Deep sequencing242 reads, 52 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6789-3p

Accession MIMAT0027479
Sequence

78 - 

cggcgcccgugucuccuccag

 - 98

Get sequence
Deep sequencing16 reads, 13 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).