Stem-loop sequence hsa-mir-6788

AccessionMI0022633 (change log)
Symbol HGNC:MIR6788
DescriptionHomo sapiens miR-6788 stem-loop
Literature search

1 open access papers mention hsa-mir-6788
(1 sentences)

Stem-loop
   gacg  u     aa          gaag     u 
5'     gc gggag  gaguggugaa    aguau g
       || |||||  ||||||||||    ||||| a
3'     cg cccuc  uucaccgcuu    ucgug u
   --ga  u     cc          ---g     u 
Get sequence
Deep sequencing
74 reads, 65.1 reads per million, 43 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr18: 10759584-10759649 [-]
sense
OTTHUMT00000254528 ; PIEZO2-007; intron 23
OTTHUMT00000442385 ; PIEZO2-003; intron 23
OTTHUMT00000446340 ; PIEZO2-015; intron 24
OTTHUMT00000442331 ; PIEZO2-006; intron 25
ENST00000383408 ; PIEZO2-202; intron 10
ENST00000302079 ; PIEZO2-007; intron 23
ENST00000503781 ; PIEZO2-003; intron 23
ENST00000582913 ; PIEZO2-015; intron 24
ENST00000580640 ; PIEZO2-006; intron 25
Database links

Mature sequence hsa-miR-6788-5p

Accession MIMAT0027476
Sequence

6 - 

cugggagaagaguggugaaga

 - 26

Get sequence
Deep sequencing54 reads, 32 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6788-3p

Accession MIMAT0027477
Sequence

45 - 

uucgccacuucccucccugcag

 - 66

Get sequence
Deep sequencing13 reads, 10 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).