Stem-loop sequence hsa-mir-6787

AccessionMI0022632 (change log)
Symbol HGNC:MIR6787
DescriptionHomo sapiens miR-6787 stem-loop
Literature search

1 open access papers mention hsa-mir-6787
(1 sentences)

Stem-loop
   ucgg    c        -      cu ca     
5'     cugg ggggguag agcugg  g  ggcc 
       |||| |||||||| ||||||  |  ||| c
3'     gacc cucccguc ucgacu  c  ccgg 
   ----    u        g      cu -c     
Get sequence
Deep sequencing
32 reads, 0 reads per million, 28 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 82236668-82236728 [+]
intergenic
Database links

Mature sequence hsa-miR-6787-5p

Accession MIMAT0027474
Sequence

6 - 

uggcggggguagagcuggcugc

 - 27

Get sequence
Deep sequencing9 reads, 9 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6787-3p

Accession MIMAT0027475
Sequence

40 - 

ucucagcugcugcccucuccag

 - 61

Get sequence
Deep sequencing9 reads, 9 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).