Stem-loop sequence hsa-mir-6786

AccessionMI0022631 (change log)
Symbol HGNC:MIR6786
DescriptionHomo sapiens miR-6786 stem-loop
Literature search

1 open access papers mention hsa-mir-6786
(1 sentences)

Stem-loop
   gccggguggggcggggcggccucaggaggggcccagcuccccuggaugug   c  ug  gc    -          g  c 
5'                                                   cug gg  gg  cgga ggggcgucac ug a
                                                     ||| ||  ||  |||| |||||||||| ||  
3'                                                   gac cc  cu  gucu ccccgcagug ac c
   --------------------------------------------------   u  gu  ua    u          a  c 
Get sequence
Deep sequencing
378 reads, 13.8 reads per million, 87 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 81693757-81693869 [+]
intergenic
Database links

Mature sequence hsa-miR-6786-5p

Accession MIMAT0027472
Sequence

53 - 

gcgguggggccggaggggcgu

 - 73

Get sequence
Deep sequencing11 reads, 9 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6786-3p

Accession MIMAT0027473
Sequence

88 - 

ugacgccccuucugauucugccu

 - 110

Get sequence
Deep sequencing38 reads, 28 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).