Stem-loop sequence hsa-mir-6785

AccessionMI0022630 (change log)
Symbol HGNC:MIR6785
DescriptionHomo sapiens miR-6785 stem-loop
Literature search

1 open access papers mention hsa-mir-6785
(1 sentences)

Stem-loop
   cucc     ag  c    -a     g    a -a   gcc  a 
5'     cuggg  gg gugg  ugaug uggg g  gga   cc c
       |||||  || ||||  ||||| |||| |  |||   || u
3'     gaccc  uc cacc  gcuac accc c  ucu   gg g
   ----     cu  -    cc     -    c ag   gaa  u 
Get sequence
Deep sequencing
90 reads, 2.78 reads per million, 36 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 75498548-75498628 [+]
intergenic
Database links

Mature sequence hsa-miR-6785-5p

Accession MIMAT0027470
Sequence

6 - 

ugggagggcguggaugauggug

 - 27

Get sequence
Deep sequencing73 reads, 29 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6785-3p

Accession MIMAT0027471
Sequence

61 - 

acaucgccccaccuuccccag

 - 81

Get sequence
Deep sequencing8 reads, 3 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).