Stem-loop sequence hsa-mir-6784

AccessionMI0022629 (change log)
Symbol HGNC:MIR6784
DescriptionHomo sapiens miR-6784 stem-loop
Stem-loop
   uacaggcc     ---u     u a      cccg  g 
5'         ggggc    uuggg g gggacc    ga u
           |||||    ||||| | ||||||    || c
3'         ccccg    aaccc c cucugg    cu u
   ------ga     ucuc     - a      --ca  g 
Get sequence
Deep sequencing
18 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 45114367-45114433 [-]
sense
OTTHUMT00000440920 ; RP11-156P1.3-007; intron 2
OTTHUMT00000440924 ; RP11-156P1.3-009; intron 2
OTTHUMT00000440921 ; RP11-156P1.3-008; intron 3
ENST00000575930 ; RP11-156P1.3-007; intron 2
ENST00000575173 ; RP11-156P1.3-009; intron 2
ENST00000571901 ; RP11-156P1.3-008; intron 3
antisense
OTTHUMT00000440448 ; RP11-156P1.1-002; intron 2
OTTHUMT00000440449 ; RP11-156P1.1-001; intron 5
OTTHUMT00000440447 ; RP11-156P1.2-001; intron 9
ENST00000570478 ; LRRC37A17P-002; intron 2
ENST00000570311 ; LRRC37A17P-001; intron 5
ENST00000571841 ; RP11-156P1.2-001; intron 9
Database links

Mature sequence hsa-miR-6784-5p

Accession MIMAT0027468
Sequence

6 - 

gccggggcuuugggugaggg

 - 25

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6784-3p

Accession MIMAT0027469
Sequence

46 - 

ucucaccccaacucugccccag

 - 67

Get sequence
Deep sequencing16 reads, 8 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).