Stem-loop sequence hsa-mir-6783

AccessionMI0022628 (change log)
Symbol HGNC:MIR6783
DescriptionHomo sapiens miR-6783 stem-loop
Stem-loop
   ccugu       a      -u  uc    aacc 
5'      uagggga aagucc  ga  cggg    c
        ||||||| ||||||  ||  ||||     
3'      gucuccu uucggg  cu  gccc    a
   --gau       c      uc  -u    cgac 
Get sequence
Deep sequencing
73 reads, 0 reads per million, 39 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 44934618-44934681 [-]
antisense
OTTHUMT00000440431 ; WNT9B-004; intron 1
OTTHUMT00000440433 ; WNT9B-001; intron 1
OTTHUMT00000440434 ; WNT9B-002; intron 1
ENST00000575372 ; WNT9B-004; intron 1
ENST00000290015 ; WNT9B-001; intron 1
ENST00000393461 ; WNT9B-002; intron 1
Database links

Mature sequence hsa-miR-6783-5p

Accession MIMAT0027466
Sequence

6 - 

uaggggaaaaguccugauccgg

 - 27

Get sequence
Deep sequencing42 reads, 21 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6783-3p

Accession MIMAT0027467
Sequence

43 - 

uuccugggcuucuccucuguag

 - 64

Get sequence
Deep sequencing28 reads, 22 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).