Stem-loop sequence hsa-mir-6782

AccessionMI0022627 (change log)
Symbol HGNC:MIR6782
DescriptionHomo sapiens miR-6782 stem-loop
Stem-loop
   uggg      gug     auu        u  aa u 
5'     guaggg   gggga   caggggug cg  c c
       ||||||   |||||   |||||||| ||  |  
3'     cguccu   ccccu   guuuccac gu  g a
   --ga      --a     -gu        c  cg u 
Get sequence
Deep sequencing
44 reads, 0 reads per million, 27 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 44207771-44207839 [-]
sense
OTTHUMT00000440272 ; RP11-669E14.5-006; intron 1
OTTHUMT00000440280 ; RP11-669E14.5-016; intron 1
OTTHUMT00000440270 ; RP11-669E14.5-001; intron 2
OTTHUMT00000440273 ; RP11-669E14.5-002; intron 2
OTTHUMT00000440274 ; RP11-669E14.5-003; intron 2
ENST00000575318 ; KANSL1-006; intron 1
ENST00000577114 ; KANSL1-016; intron 1
ENST00000432791 ; KANSL1-202; intron 1
ENST00000574590 ; KANSL1-001; intron 2
ENST00000572904 ; KANSL1-002; intron 2
ENST00000262419 ; KANSL1-003; intron 2
ENST00000393476 ; KANSL1-201; intron 2
Database links

Mature sequence hsa-miR-6782-5p

Accession MIMAT0027464
Sequence

6 - 

uaggggugggggaauucaggggugu

 - 30

Get sequence
Deep sequencing9 reads, 8 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6782-3p

Accession MIMAT0027465
Sequence

46 - 

caccuuuguguccccauccugca

 - 68

Get sequence
Deep sequencing33 reads, 20 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).