Stem-loop sequence hsa-mir-6781

AccessionMI0022626 (change log)
Symbol HGNC:MIR6781
DescriptionHomo sapiens miR-6781 stem-loop
Stem-loop
   aacccc      ga  uc     c  c  uucu 
5'       gggccg  gg  aaggg gu gc    c
         ||||||  ||  ||||| || ||    c
3'       uccggc  cc  uucuc cg ug    c
   ---gac      -a  uu     -  u  uaau 
Get sequence
Deep sequencing
47 reads, 0 reads per million, 28 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 42823880-42823943 [-]
antisense
OTTHUMT00000385937 ; DBF4B-004; intron 4
OTTHUMT00000385931 ; DBF4B-002; intron 9
OTTHUMT00000385926 ; DBF4B-003; intron 10
OTTHUMT00000385930 ; DBF4B-001; intron 10
ENST00000527862 ; DBF4B-004; intron 4
ENST00000526924 ; DBF4B-002; intron 9
ENST00000393547 ; DBF4B-003; intron 10
ENST00000315005 ; DBF4B-001; intron 10
Database links

Mature sequence hsa-miR-6781-5p

Accession MIMAT0027462
Sequence

6 - 

cgggccggaggucaagggcgu

 - 26

Get sequence
Deep sequencing20 reads, 16 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6781-3p

Accession MIMAT0027463
Sequence

43 - 

ugccucuuuuccacggccucag

 - 64

Get sequence
Deep sequencing26 reads, 15 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).