Stem-loop sequence hsa-mir-6780b

AccessionMI0022681 (change log)
Symbol HGNC:MIR6780B
DescriptionHomo sapiens miR-6780b stem-loop
Stem-loop
   cagc          cuu       a   ca a   gc    c 
5'     cuggggaagg   ggcaggg aga  c uga  agug c
       ||||||||||   ||||||| |||  | |||  ||||  
3'     gaucccuuuc   cuguucc ucu  g acu  ucac u
   ----          -cu       c   cc c   --    c 
Get sequence
Deep sequencing
88 reads, 0 reads per million, 34 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 43434542-43434620 [+]
intergenic
Database links

Mature sequence hsa-miR-6780b-5p

Accession MIMAT0027572
Sequence

6 - 

uggggaaggcuuggcagggaaga

 - 28

Get sequence
Deep sequencing27 reads, 16 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6780b-3p

Accession MIMAT0027573
Sequence

59 - 

ucccuugucuccuuucccuag

 - 79

Get sequence
Deep sequencing56 reads, 26 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).