Stem-loop sequence hsa-mir-6780a

AccessionMI0022625 (change log)
Symbol HGNC:MIR6780A
DescriptionHomo sapiens miR-6780a stem-loop
Literature search

1 open access papers mention hsa-mir-6780a
(46 sentences)

Stem-loop
   gacacu               cu    a u   g ca 
5'       ugggagggaagacag  ggag g aug u  c
         |||||||||||||||  |||| | ||| |   
3'       auccuuucuuuuguc  ccuc c uac a  a
   -----g               -u    - -   g cg 
Get sequence
Deep sequencing
224 reads, 0 reads per million, 69 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 42708084-42708151 [-]
intergenic
Database links

Mature sequence hsa-miR-6780a-5p

Accession MIMAT0027460
Sequence

6 - 

uugggagggaagacagcuggaga

 - 28

Get sequence
Deep sequencing190 reads, 51 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6780a-3p

Accession MIMAT0027461
Sequence

48 - 

cuccucuguuuucuuuccuag

 - 68

Get sequence
Deep sequencing25 reads, 18 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).