Stem-loop sequence hsa-mir-6779

AccessionMI0022624 (change log)
Symbol HGNC:MIR6779
DescriptionHomo sapiens miR-6779 stem-loop
Stem-loop
   --gagcuc       -   u        c   a 
5'         ugggagg ggc ggguuugg agg c
           ||||||| ||| |||||||| |||  
3'         acccucc cug cccgaacc uuu a
   gaccuucu       u   u        -   g 
Get sequence
Deep sequencing
98 reads, 6.67 reads per million, 45 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 38914979-38915042 [+]
intergenic
Database links

Mature sequence hsa-miR-6779-5p

Accession MIMAT0027458
Sequence

6 - 

cugggaggggcuggguuuggc

 - 26

Get sequence
Deep sequencing74 reads, 30 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6779-3p

Accession MIMAT0027459
Sequence

39 - 

aagcccugucuccucccaucu

 - 59

Get sequence
Deep sequencing21 reads, 18 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).