Stem-loop sequence hsa-mir-6778

AccessionMI0022623 (change log)
Symbol HGNC:MIR6778
DescriptionHomo sapiens miR-6778 stem-loop
Literature search

1 open access papers mention hsa-mir-6778
(2 sentences)

Stem-loop
   guucaa      gga    -        -gu     ga 
5'       guggga   cagg aggcaggu   gguug  g
         ||||||   |||| ||||||||   |||||  g
3'       caccuu   gucc uccgucca   ccgac  a
   ----ga      aca    c        agu     ga 
Get sequence
Deep sequencing
59 reads, 5.13 reads per million, 39 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 18340814-18340886 [-]
antisense
OTTHUMT00000446576 ; KRT16P1-003; intron 1
ENST00000581027 ; KRT16P1-003; intron 1
Database links

Mature sequence hsa-miR-6778-5p

Accession MIMAT0027456
Sequence

6 - 

agugggaggacaggaggcaggu

 - 27

Get sequence
Deep sequencing36 reads, 24 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6778-3p

Accession MIMAT0027457
Sequence

53 - 

ugccucccugacauuccacag

 - 73

Get sequence
Deep sequencing10 reads, 7 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).