Stem-loop sequence hsa-mir-6777

AccessionMI0022622 (change log)
Symbol HGNC:MIR6777
DescriptionHomo sapiens miR-6777 stem-loop
Literature search

2 open access papers mention hsa-mir-6777
(2 sentences)

Stem-loop
   ucaagac    a      -c     u  agau  a 
5'        gggg gucagg  agugg gg    gg g
          |||| ||||||  ||||| ||    || a
3'        cccc cggucc  ucacc cc    cc g
   -----ga    -      uc     u  gagu  c 
Get sequence
Deep sequencing
324 reads, 0 reads per million, 75 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 17813480-17813545 [-]
sense
OTTHUMT00000131929 ; TOM1L2-002; intron 1
OTTHUMT00000131928 ; TOM1L2-001; intron 1
OTTHUMT00000443246 ; TOM1L2-010; intron 1
OTTHUMT00000131931 ; TOM1L2-004; intron 1
OTTHUMT00000443248 ; TOM1L2-007; intron 1
OTTHUMT00000443249 ; TOM1L2-009; intron 1
OTTHUMT00000443250 ; TOM1L2-008; intron 1
OTTHUMT00000443252 ; TOM1L2-011; intron 1
OTTHUMT00000443253 ; TOM1L2-012; intron 1
ENST00000581396 ; TOM1L2-002; intron 1
ENST00000379504 ; TOM1L2-001; intron 1
ENST00000318094 ; TOM1L2-010; intron 1
ENST00000395739 ; TOM1L2-004; intron 1
ENST00000535933 ; TOM1L2-007; intron 1
ENST00000540946 ; TOM1L2-009; intron 1
ENST00000542206 ; TOM1L2-008; intron 1
ENST00000537091 ; TOM1L2-011; intron 1
ENST00000579586 ; TOM1L2-012; intron 1
Clustered miRNAs
< 10kb from hsa-mir-6777
hsa-mir-33bchr17: 17813836-17813931 [-]
hsa-mir-6777chr17: 17813480-17813545 [-]
Database links

Mature sequence hsa-miR-6777-5p

Accession MIMAT0027454
Sequence

6 - 

acggggagucaggcaguggugga

 - 28

Get sequence
Deep sequencing235 reads, 54 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6777-3p

Accession MIMAT0027455
Sequence

47 - 

uccacucuccuggcccccag

 - 66

Get sequence
Deep sequencing30 reads, 15 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).