Stem-loop sequence hsa-mir-6776

AccessionMI0022621 (change log)
Symbol HGNC:MIR6776
DescriptionHomo sapiens miR-6776 stem-loop
Stem-loop
   -c   cucu   u       g    c  ac 
5'   ggg    ggg gcagugg gguu cc  g
     |||    ||| ||||||| |||| ||  c
3'   ccc    cuc ugucacc ccaa gg  c
   ga   --cu   -       a    c  cg 
Get sequence
Deep sequencing
30 reads, 0 reads per million, 17 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 2692861-2692919 [-]
antisense
OTTHUMT00000438367 ; RAP1GAP2-003; intron 1
ENST00000540393 ; RAP1GAP2-003; intron 1
Database links

Mature sequence hsa-miR-6776-5p

Accession MIMAT0027452
Sequence

6 - 

ucugggugcaguggggguu

 - 24

Get sequence
Deep sequencing13 reads, 8 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6776-3p

Accession MIMAT0027453
Sequence

37 - 

caaccaccacugucucuccccag

 - 59

Get sequence
Deep sequencing17 reads, 13 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).