Stem-loop sequence hsa-mir-6775

AccessionMI0022620 (change log)
Symbol HGNC:MIR6775
DescriptionHomo sapiens miR-6775 stem-loop
Stem-loop
   gaaccuc      u    g    agg    acag   a 
5'        ggggca gggg aggg   cugg    gag g
          |||||| |||| ||||   ||||    |||  
3'        ccccgu uccu uccc   gacc    cuc g
   -----ga      c    g    --g    --ca   g 
Get sequence
Deep sequencing
111 reads, 0 reads per million, 42 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 87834592-87834660 [-]
sense
OTTHUMT00000431893 ; RP4-536B24.3-001; intron 1
ENST00000561567 ; RP4-536B24.3-001; intron 1
Database links

Mature sequence hsa-miR-6775-5p

Accession MIMAT0027450
Sequence

6 - 

ucggggcaugggggagggaggcugg

 - 30

Get sequence
Deep sequencing25 reads, 15 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6775-3p

Accession MIMAT0027451
Sequence

49 - 

aggcccuguccucugccccag

 - 69

Get sequence
Deep sequencing76 reads, 30 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).