Stem-loop sequence hsa-mir-6774

AccessionMI0022619 (change log)
Symbol HGNC:MIR6774
DescriptionHomo sapiens miR-6774 stem-loop
Stem-loop
   ugugcacu              ccuguaugucuccc 
5'         ugggcaggagggac              c
           ||||||||||||||              g
3'         accuguucucccug              c
   -----gac              ugcuacugccacga 
Get sequence
Deep sequencing
31 reads, 0 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 85918347-85918416 [+]
intergenic
Database links

Mature sequence hsa-miR-6774-5p

Accession MIMAT0027448
Sequence

6 - 

acuugggcaggagggacccuguaug

 - 30

Get sequence
Deep sequencing9 reads, 7 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6774-3p

Accession MIMAT0027449
Sequence

50 - 

ucgugucccucuuguccacag

 - 70

Get sequence
Deep sequencing21 reads, 9 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).