Stem-loop sequence hsa-mir-6773

AccessionMI0022618 (change log)
Symbol HGNC:MIR6773
DescriptionHomo sapiens miR-6773 stem-loop
Stem-loop
   gggagu     cc      aa    -  -------     gc 
5'       ugggc  aggagu  acag ga       uuagu  u
         |||||  ||||||  |||| ||       |||||   
3'       acccg  ucuuca  uguc cu       aaucg  u
   ---gau     uc      -c    a  ucuguag     ua 
Get sequence
Deep sequencing
35 reads, 0 reads per million, 24 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 68233426-68233499 [-]
antisense
OTTHUMT00000432757 ; NFATC3-013; intron 9
OTTHUMT00000432758 ; NFATC3-014; intron 9
OTTHUMT00000432759 ; NFATC3-015; intron 9
OTTHUMT00000436934 ; NFATC3-023; intron 9
OTTHUMT00000268889 ; NFATC3-001; intron 9
OTTHUMT00000268890 ; NFATC3-002; intron 9
OTTHUMT00000268891 ; NFATC3-003; intron 9
OTTHUMT00000432764 ; NFATC3-016; intron 9
OTTHUMT00000432765 ; NFATC3-017; intron 9
OTTHUMT00000432766 ; NFATC3-018; intron 9
OTTHUMT00000432767 ; NFATC3-019; intron 9
OTTHUMT00000432768 ; NFATC3-020; intron 9
OTTHUMT00000432769 ; NFATC3-021; intron 9
ENST00000569766 ; NFATC3-013; intron 9
ENST00000563319 ; NFATC3-014; intron 9
ENST00000566301 ; NFATC3-015; intron 9
ENST00000575270 ; NFATC3-023; intron 9
ENST00000349223 ; NFATC3-001; intron 9
ENST00000346183 ; NFATC3-002; intron 9
ENST00000329524 ; NFATC3-003; intron 9
ENST00000570212 ; NFATC3-016; intron 9
ENST00000562926 ; NFATC3-017; intron 9
ENST00000567152 ; NFATC3-018; intron 9
ENST00000563796 ; NFATC3-019; intron 9
ENST00000563288 ; NFATC3-020; intron 9
ENST00000535127 ; NFATC3-021; intron 9
Database links

Mature sequence hsa-miR-6773-5p

Accession MIMAT0027446
Sequence

6 - 

uugggcccaggaguaaacaggau

 - 28

Get sequence
Deep sequencing18 reads, 15 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6773-3p

Accession MIMAT0027447
Sequence

53 - 

acugucacuucucugcccauag

 - 74

Get sequence
Deep sequencing14 reads, 11 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).