Stem-loop sequence hsa-mir-6771

AccessionMI0022616 (change log)
Symbol HGNC:MIR6771
DescriptionHomo sapiens miR-6771 stem-loop
Literature search

1 open access papers mention hsa-mir-6771
(1 sentences)

Stem-loop
   ggugc  -    a     u   cca   -  c 
5'      cu cggg gggca ggg   ggc ca a
        || |||| ||||| |||   ||| || u
3'      ga gccc ucugu ccc   ccg gu a
   -----  c    a     c   aaa   a  a 
Get sequence
Deep sequencing
36 reads, 5.56 reads per million, 18 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 50292616-50292675 [+]
sense
OTTHUMT00000423153 ; ADCY7-014; intron 1
OTTHUMT00000423154 ; ADCY7-013; intron 1
ENST00000564965 ; ADCY7-014; intron 1
ENST00000564044 ; ADCY7-013; intron 1
Database links

Mature sequence hsa-miR-6771-5p

Accession MIMAT0027442
Sequence

6 - 

cucgggagggcaugggccaggc

 - 27

Get sequence
Deep sequencing34 reads, 18 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6771-3p

Accession MIMAT0027443
Sequence

40 - 

caaaccccugucuacccgcag

 - 60

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).