Stem-loop sequence hsa-mir-6770-1

AccessionMI0022615 (change log)
Symbol HGNC:MIR6770-1
DescriptionHomo sapiens miR-6770-1 stem-loop
Gene family MIPF0001692; mir-6770
Stem-loop
   uauc   a            u  a  u a  u 
5'     cug gaaggcacagcu gc cg g cc c
       ||| |||||||||||| || || | ||  
3'     gac cuucugugucgg cg gu c gg c
   ----   a            -  -  c g  u 
Get sequence
Deep sequencing
305 reads, 0 reads per million, 77 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 14930820-14930879 [+]
sense
OTTHUMT00000207065 ; NOMO1-001; intron 1
ENST00000287667 ; NOMO1-001; intron 1
Clustered miRNAs
< 10kb from hsa-mir-6770-1
hsa-mir-6511a-1chr16: 14925937-14926003 [+]
hsa-mir-6770-1chr16: 14930820-14930879 [+]
Database links

Mature sequence hsa-miR-6770-5p

Accession MIMAT0027440
Sequence

6 - 

ugagaaggcacagcuugcacguga

 - 29

Get sequence
Deep sequencing720 reads, 71 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6770-3p

Accession MIMAT0027441
Sequence

40 - 

cuggcggcugugucuucacag

 - 60

Get sequence
Deep sequencing192 reads, 24 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).