Stem-loop sequence hsa-mir-6769b

AccessionMI0022706 (change log)
Symbol HGNC:MIR6769B
DescriptionHomo sapiens miR-6769b stem-loop
Stem-loop
   cuuccug         ga     a u  -   c 
5'        guggguggg  ggaga g gc cgu c
          |||||||||  ||||| | || |||  
3'        uacccaccc  ucucu c cg gua u
   -----ga         ug     c c  a   c 
Get sequence
Deep sequencing
71 reads, 0 reads per million, 28 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 206474803-206474864 [+]
intergenic
Database links

Mature sequence hsa-miR-6769b-5p

Accession MIMAT0027620
Sequence

6 - 

ugguggguggggaggagaagugc

 - 28

Get sequence
Deep sequencing41 reads, 18 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6769b-3p

Accession MIMAT0027621
Sequence

42 - 

cccucucugucccacccauag

 - 62

Get sequence
Deep sequencing27 reads, 15 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).