Stem-loop sequence hsa-mir-6769a

AccessionMI0022614 (change log)
Symbol HGNC:MIR6769A
DescriptionHomo sapiens miR-6769a stem-loop
Stem-loop
   aggcca  u     u     a  cc    au   ---a u 
5'       gg gggua ggagg gc  ucau  ggc    g u
         || ||||| ||||| ||  ||||  |||    |  
3'       cc cucgu ucucc cg  agug  ccg    c g
   ----ga  u     c     c  --    ac   ggag g 
Get sequence
Deep sequencing
62 reads, 0 reads per million, 22 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 4671318-4671390 [+]
sense
OTTHUMT00000432056 ; MGRN1-007; intron 1
ENST00000591895 ; MGRN1-007; intron 1
Database links

Mature sequence hsa-miR-6769a-5p

Accession MIMAT0027438
Sequence

6 - 

agguggguauggaggagcccu

 - 26

Get sequence
Deep sequencing34 reads, 12 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6769a-3p

Accession MIMAT0027439
Sequence

53 - 

gagccccucucugcucuccag

 - 73

Get sequence
Deep sequencing28 reads, 16 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).