Stem-loop sequence hsa-mir-6768

AccessionMI0022613 (change log)
Symbol HGNC:MIR6768
DescriptionHomo sapiens miR-6768 stem-loop
Stem-loop
   ccaggca       a  gcgg    --cu    ucg 
5'        cacagga aa    ggcc    gggu   g
          ||||||| ||    ||||    ||||   c
3'        guguccu uu    ccgg    ccca   u
   gacacac       c  -aca    aaac    ucg 
Get sequence
Deep sequencing
28 reads, 0 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 2463967-2464038 [+]
sense
OTTHUMT00000334904 ; ABCA17P-002; intron 13
OTTHUMT00000334903 ; ABCA17P-001; intron 13
ENST00000469908 ; ABCA17P-002; intron 13
ENST00000494925 ; ABCA17P-001; intron 13
Database links

Mature sequence hsa-miR-6768-5p

Accession MIMAT0027436
Sequence

6 - 

cacacaggaaaagcggggcccug

 - 28

Get sequence
Deep sequencing19 reads, 9 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6768-3p

Accession MIMAT0027437
Sequence

45 - 

caaaggccacauucuccugugcac

 - 68

Get sequence
Deep sequencing7 reads, 7 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).