Stem-loop sequence hsa-mir-6767

AccessionMI0022612 (change log)
Symbol HGNC:MIR6767
DescriptionHomo sapiens miR-6767 stem-loop
Literature search

1 open access papers mention hsa-mir-6767
(24 sentences)

Stem-loop
   ugaaauc  a  c     --   a   a    gccc 
5'        gc ga aggga  cac ugg gaac    c
          || || |||||  ||| ||| ||||     
3'        cg cu ucucu  gug acc cuug    c
   -----ga  c  u     uc   c   -    acca 
Get sequence
Deep sequencing
312 reads, 0 reads per million, 41 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 2445392-2445457 [+]
sense
OTTHUMT00000334904 ; ABCA17P-002; intron 8
OTTHUMT00000334903 ; ABCA17P-001; intron 8
ENST00000469908 ; ABCA17P-002; intron 8
ENST00000494925 ; ABCA17P-001; intron 8
Database links

Mature sequence hsa-miR-6767-5p

Accession MIMAT0027434
Sequence

6 - 

ucgcagacagggacacauggaga

 - 28

Get sequence
Deep sequencing299 reads, 35 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6767-3p

Accession MIMAT0027435
Sequence

45 - 

ccacgugcuucucuuuccgcag

 - 66

Get sequence
Deep sequencing13 reads, 8 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).