Stem-loop sequence hsa-mir-6766

AccessionMI0022611 (change log)
Symbol HGNC:MIR6766
DescriptionHomo sapiens miR-6766 stem-loop
Stem-loop
   a  a c       a c    cuu   ga    uccu 
5'  ug g ggguggg g agau   auu  gagu    u
    || | ||||||| | ||||   |||  ||||     
3'  ac c cccaccc c ucug   uag  cucg    c
   g  a u       c u    --u   uc    uccu 
Get sequence
Deep sequencing
82 reads, 0 reads per million, 44 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 89326739-89326810 [-]
intergenic
Database links

Mature sequence hsa-miR-6766-5p

Accession MIMAT0027432
Sequence

6 - 

cgggugggagcagaucuuauugag

 - 29

Get sequence
Deep sequencing11 reads, 9 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6766-3p

Accession MIMAT0027433
Sequence

48 - 

ugauugucuucccccacccuca

 - 69

Get sequence
Deep sequencing59 reads, 35 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).