Stem-loop sequence hsa-mir-6765

AccessionMI0022610 (change log)
Symbol HGNC:MIR6765
DescriptionHomo sapiens miR-6765 stem-loop
Stem-loop
   g  a      g    ga     u   --g  ug  ug  ---   g 
5'  ug ggcggg ccag  gggug gug   cg  gg  cu   gcg g
    || |||||| ||||  ||||| |||   ||  ||  ||   |||  
3'  ac ccgccc gguc  uccac cgc   gc  cc  gg   ugc g
   g  -      -    gg     u   agg  gu  gu  gac   c 
Get sequence
Deep sequencing
128 reads, 9.09 reads per million, 44 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 105150778-105150864 [-]
antisense
OTTHUMT00000410526 ; RP11-982M15.6-001; exon 2
ENST00000540171 ; RP11-982M15.6-001; exon 2
Database links

Mature sequence hsa-miR-6765-5p

Accession MIMAT0027430
Sequence

1 - 

gugaggcggggccaggagggugugu

 - 25

Get sequence
Deep sequencing15 reads, 11 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6765-3p

Accession MIMAT0027431
Sequence

67 - 

ucaccuggcuggcccgcccag

 - 87

Get sequence
Deep sequencing102 reads, 37 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).