Stem-loop sequence hsa-mir-6764

AccessionMI0022609 (change log)
Symbol HGNC:MIR6764
DescriptionHomo sapiens miR-6764 stem-loop
Literature search

1 open access papers mention hsa-mir-6764
(3 sentences)

Stem-loop
   cugacucc     ucu gu     --uu   g 
5'         caggg   g  cagag    gcu a
           |||||   |  |||||    ||| g
3'         guucc   c  gucuc    ugg u
   ----gaca     uuu ug     uagu   g 
Get sequence
Deep sequencing
95 reads, 2.33 reads per million, 43 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 100277357-100277417 [+]
sense
OTTHUMT00000413938 ; EML1-004; intron 1
OTTHUMT00000413939 ; EML1-006; intron 1
OTTHUMT00000413940 ; EML1-003; intron 1
OTTHUMT00000413941 ; EML1-007; intron 1
OTTHUMT00000413942 ; EML1-008; intron 1
OTTHUMT00000413943 ; EML1-001; intron 1
OTTHUMT00000413944 ; EML1-002; intron 1
OTTHUMT00000413945 ; EML1-009; intron 1
OTTHUMT00000413946 ; EML1-010; intron 1
OTTHUMT00000413947 ; EML1-011; intron 1
ENST00000554479 ; EML1-004; intron 1
ENST00000555145 ; EML1-006; intron 1
ENST00000327921 ; EML1-003; intron 1
ENST00000556199 ; EML1-007; intron 1
ENST00000556835 ; EML1-008; intron 1
ENST00000262233 ; EML1-001; intron 1
ENST00000334192 ; EML1-002; intron 1
ENST00000555096 ; EML1-009; intron 1
ENST00000556714 ; EML1-010; intron 1
ENST00000553720 ; EML1-011; intron 1
Database links

Mature sequence hsa-miR-6764-5p

Accession MIMAT0027428
Sequence

6 - 

ucccagggucuggucagaguug

 - 27

Get sequence
Deep sequencing70 reads, 31 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6764-3p

Accession MIMAT0027429
Sequence

41 - 

ucucuggucuuuccuugacag

 - 61

Get sequence
Deep sequencing16 reads, 10 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).