Stem-loop sequence hsa-mir-6763

AccessionMI0022608 (change log)
Symbol HGNC:MIR6763
DescriptionHomo sapiens miR-6763 stem-loop
Stem-loop
   uucuc      --  u            gac  ac 
5'      cugggg  ag ggcuggggagca   ag  c
        ||||||  || ||||||||||||   ||  c
3'      gacccc  uc ccggccccucgu   uc  a
   -----      cg  u            -ac  ca 
Get sequence
Deep sequencing
123 reads, 5.56 reads per million, 54 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 132581997-132582061 [+]
sense
OTTHUMT00000398971 ; EP400NL-013; intron 1
OTTHUMT00000398973 ; EP400NL-014; intron 1
OTTHUMT00000398974 ; EP400NL-015; intron 1
OTTHUMT00000316707 ; EP400NL-004; intron 1
OTTHUMT00000316709 ; EP400NL-006; intron 2
OTTHUMT00000316704 ; EP400NL-001; intron 2
OTTHUMT00000316706 ; EP400NL-003; intron 3
OTTHUMT00000316708 ; EP400NL-005; intron 3
OTTHUMT00000398972 ; EP400NL-008; intron 3
ENST00000454179 ; EP400NL-013; intron 1
ENST00000407361 ; EP400NL-014; intron 1
ENST00000539205 ; EP400NL-015; intron 1
ENST00000332441 ; EP400NL-004; intron 1
ENST00000361109 ; EP400NL-201; intron 1
ENST00000446190 ; EP400NL-006; intron 2
ENST00000392352 ; EP400NL-001; intron 2
ENST00000488030 ; EP400NL-003; intron 3
ENST00000389560 ; EP400NL-005; intron 3
ENST00000443539 ; EP400NL-008; intron 3
Database links

Mature sequence hsa-miR-6763-5p

Accession MIMAT0027426
Sequence

6 - 

cuggggaguggcuggggag

 - 24

Get sequence
Deep sequencing59 reads, 34 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6763-3p

Accession MIMAT0027427
Sequence

45 - 

cuccccggccucugcccccag

 - 65

Get sequence
Deep sequencing58 reads, 28 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).