Stem-loop sequence hsa-mir-6762

AccessionMI0022607 (change log)
Symbol HGNC:MIR6762
DescriptionHomo sapiens miR-6762 stem-loop
Literature search

1 open access papers mention hsa-mir-6762
(1 sentences)

Stem-loop
   --a   -      ccau         u   u  ac    acc     u 
5'    gag ccgggg    ggagcagcc gug ag  gggg   ugccc g
      ||| ||||||    ||||||||| ||| ||  ||||   ||||| c
3'    cuc gguucc    cuucgucgg cac uc  cccc   acggg a
   gac   u      ----         u   -  --    ---     u 
Get sequence
Deep sequencing
75 reads, 0 reads per million, 36 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 113291523-113291608 [+]
sense
OTTHUMT00000405567 ; RPH3A-008; intron 1
OTTHUMT00000405566 ; RPH3A-003; intron 3
OTTHUMT00000405811 ; RPH3A-021; intron 4
OTTHUMT00000405562 ; RPH3A-007; intron 4
OTTHUMT00000405563 ; RPH3A-001; intron 4
OTTHUMT00000405565 ; RPH3A-004; intron 4
OTTHUMT00000405564 ; RPH3A-009; intron 4
OTTHUMT00000405890 ; RPH3A-023; intron 5
OTTHUMT00000405774 ; RPH3A-013; intron 5
OTTHUMT00000405893 ; RPH3A-022; intron 5
OTTHUMT00000405783 ; RPH3A-016; intron 5
OTTHUMT00000405784 ; RPH3A-017; intron 5
OTTHUMT00000405785 ; RPH3A-018; intron 5
OTTHUMT00000405561 ; RPH3A-002; intron 5
OTTHUMT00000405790 ; RPH3A-020; intron 5
OTTHUMT00000405789 ; RPH3A-019; intron 5
OTTHUMT00000405895 ; RPH3A-027; intron 5
OTTHUMT00000405892 ; RPH3A-024; intron 6
OTTHUMT00000405894 ; RPH3A-026; intron 6
OTTHUMT00000405776 ; RPH3A-014; intron 7
ENST00000547222 ; RPH3A-008; intron 1
ENST00000548866 ; RPH3A-003; intron 3
ENST00000420983 ; RPH3A-201; intron 3
ENST00000551593 ; RPH3A-021; intron 4
ENST00000550901 ; RPH3A-007; intron 4
ENST00000551052 ; RPH3A-001; intron 4
ENST00000415485 ; RPH3A-004; intron 4
ENST00000552679 ; RPH3A-009; intron 4
ENST00000548197 ; RPH3A-023; intron 5
ENST00000543106 ; RPH3A-013; intron 5
ENST00000547840 ; RPH3A-022; intron 5
ENST00000547728 ; RPH3A-016; intron 5
ENST00000549769 ; RPH3A-017; intron 5
ENST00000552667 ; RPH3A-018; intron 5
ENST00000389385 ; RPH3A-002; intron 5
ENST00000551198 ; RPH3A-020; intron 5
ENST00000553114 ; RPH3A-019; intron 5
ENST00000547099 ; RPH3A-027; intron 5
ENST00000447659 ; RPH3A-202; intron 5
ENST00000551748 ; RPH3A-024; intron 6
ENST00000546703 ; RPH3A-026; intron 6
ENST00000547686 ; RPH3A-014; intron 7
Database links

Mature sequence hsa-miR-6762-5p

Accession MIMAT0027424
Sequence

6 - 

cggggccauggagcagccugugu

 - 28

Get sequence
Deep sequencing9 reads, 7 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6762-3p

Accession MIMAT0027425
Sequence

64 - 

uggcugcuucccuuggucuccag

 - 86

Get sequence
Deep sequencing60 reads, 29 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).