Stem-loop sequence hsa-mir-6760

AccessionMI0022605 (change log)
Symbol HGNC:MIR6760
DescriptionHomo sapiens miR-6760 stem-loop
Stem-loop
   cagugca         u  aagu    a      uca 
5'        gggagaagg gg    gcag gugggc   c
          ||||||||| ||    |||| ||||||   c
3'        cccucuucc cc    uguc cacccg   u
   ----gac         -  ----    a      cuc 
Get sequence
Deep sequencing
31 reads, 0 reads per million, 19 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 111304142-111304209 [+]
sense
OTTHUMT00000404671 ; CCDC63-004; intron 2
OTTHUMT00000404674 ; CCDC63-003; intron 2
OTTHUMT00000404672 ; CCDC63-002; intron 3
OTTHUMT00000404673 ; CCDC63-001; intron 4
ENST00000550317 ; CCDC63-004; intron 2
ENST00000552694 ; CCDC63-003; intron 2
ENST00000545036 ; CCDC63-002; intron 3
ENST00000308208 ; CCDC63-001; intron 4
Database links

Mature sequence hsa-miR-6760-5p

Accession MIMAT0027420
Sequence

6 - 

cagggagaagguggaagugcaga

 - 28

Get sequence
Deep sequencing12 reads, 10 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6760-3p

Accession MIMAT0027421
Sequence

48 - 

acacuguccccuucuccccag

 - 68

Get sequence
Deep sequencing17 reads, 14 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).