Stem-loop sequence hsa-mir-676

AccessionMI0016436 (change log)
Symbol HGNC:MIR676
DescriptionHomo sapiens miR-676 stem-loop
Gene family MIPF0000471; mir-676
Literature search

6 open access papers mention hsa-mir-676
(14 sentences)

Stem-loop
      ug    uu      c     uu   gaauu 
5' gca  acuc  caaccu aggac  gca     a
   |||  ||||  |||||| |||||  |||      
3' cgu  ugag  guugga uccug  cgu     a
      gu    uu      a     -u   aaggu 
Get sequence
Deep sequencing
997 reads, 0 reads per million, 110 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 70022857-70022923 [+]
antisense
OTTHUMT00000057083 ; TEX11-001; intron 9
OTTHUMT00000359072 ; TEX11-002; intron 10
ENST00000344304 ; TEX11-201; intron 8
ENST00000374333 ; TEX11-001; intron 9
ENST00000395889 ; TEX11-002; intron 10
Database links

Mature sequence hsa-miR-676-5p

Accession MIMAT0018203
Previous IDshsa-miR-676*
Sequence

8 - 

ucuucaaccucaggacuugca

 - 28

Get sequence
Deep sequencing156 reads, 52 experiments
Evidence experimental; Illumina [1,3]
Predicted targets

Mature sequence hsa-miR-676-3p

Accession MIMAT0018204
Previous IDshsa-miR-676
Sequence

43 - 

cuguccuaagguuguugaguu

 - 63

Get sequence
Deep sequencing834 reads, 107 experiments
Evidence experimental; Illumina [1-3]
Database links
Predicted targets

References

1
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
2
3
PMID:22454130 "Transcription factors are targeted by differentially expressed miRNAs in primates" Dannemann M, Prufer K, Lizano E, Nickel B, Burbano HA, Kelso J Genome Biol Evol. 4:552-564(2012).