Stem-loop sequence hsa-mir-6759

AccessionMI0022604 (change log)
Symbol HGNC:MIR6759
DescriptionHomo sapiens miR-6759 stem-loop
Stem-loop
   uauugu  u   --u       a   u uuuu  u 
5'       ug ggg   gggcaga guc g    cu c
         || |||   ||||||| ||| |    ||  
3'       ac ccc   uccguuu cag c    gg a
   -----g  u   cuc       c   u uuuu  u 
Get sequence
Deep sequencing
64 reads, 0 reads per million, 33 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 57748618-57748682 [-]
sense
OTTHUMT00000326571 ; R3HDM2-002; intron 1
OTTHUMT00000326570 ; R3HDM2-001; intron 2
OTTHUMT00000326572 ; R3HDM2-003; intron 2
ENST00000448732 ; R3HDM2-002; intron 1
ENST00000347140 ; R3HDM2-001; intron 2
ENST00000402412 ; R3HDM2-003; intron 2
Database links

Mature sequence hsa-miR-6759-5p

Accession MIMAT0027418
Sequence

6 - 

uugugggugggcagaagucugu

 - 27

Get sequence
Deep sequencing40 reads, 22 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6759-3p

Accession MIMAT0027419
Sequence

44 - 

ugaccuuugccucuccccucag

 - 65

Get sequence
Deep sequencing10 reads, 10 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).