Stem-loop sequence hsa-mir-6758

AccessionMI0022603 (change log)
Symbol HGNC:MIR6758
DescriptionHomo sapiens miR-6758 stem-loop
Stem-loop
   -     uag         g  u    ugu    a 
5'  ugggc   agaggggaa ga guga   gagc g
    |||||   ||||||||| || ||||   |||| a
3'  accug   ucuccucuu cu cacu   cuug u
   g     ---         a  -    ---    g 
Get sequence
Deep sequencing
139 reads, 0 reads per million, 43 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 57512688-57512750 [+]
antisense
OTTHUMT00000412251 ; STAT6-002; intron 1
OTTHUMT00000412376 ; STAT6-010; intron 1
ENST00000556155 ; STAT6-002; intron 1
ENST00000553499 ; STAT6-010; intron 1
Clustered miRNAs
< 10kb from hsa-mir-6758
hsa-mir-6758chr12: 57512688-57512750 [+]
hsa-mir-616chr12: 57519163-57519259 [-]
Database links

Mature sequence hsa-miR-6758-5p

Accession MIMAT0027416
Sequence

6 - 

uagagaggggaaggaugugaugu

 - 28

Get sequence
Deep sequencing54 reads, 22 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6758-3p

Accession MIMAT0027417
Sequence

44 - 

acucauucuccucuguccag

 - 63

Get sequence
Deep sequencing78 reads, 25 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).