Stem-loop sequence hsa-mir-6757

AccessionMI0022602 (change log)
Symbol HGNC:MIR6757
DescriptionHomo sapiens miR-6757 stem-loop
Stem-loop
   gggcuua       -        - a  aa     a 
5'        gggaugg gaggccag g ug  gauua u
          ||||||| |||||||| | ||  ||||| c
3'        cccuauc uuccgguc c ac  cuaau c
   ----gac       g        a a  cc     c 
Get sequence
Deep sequencing
42 reads, 3.33 reads per million, 30 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 53056944-53057012 [+]
intergenic
Database links

Mature sequence hsa-miR-6757-5p

Accession MIMAT0027414
Sequence

6 - 

uagggaugggaggccaggauga

 - 27

Get sequence
Deep sequencing26 reads, 22 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6757-3p

Accession MIMAT0027415
Sequence

47 - 

aacacuggccuugcuaucccca

 - 68

Get sequence
Deep sequencing13 reads, 10 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).