Stem-loop sequence hsa-mir-6755

AccessionMI0022600 (change log)
Symbol HGNC:MIR6755
DescriptionHomo sapiens miR-6755 stem-loop
Stem-loop
   uguuu     --u     c        uuaugugu   c 
5'      uaggg   agaca ugacaacg        ggu u
        |||||   ||||| ||||||||        ||| u
3'      auccc   uuugu acuguugu        cca u
   ----g     uuu     -        --------   a 
Get sequence
Deep sequencing
47 reads, 0 reads per million, 17 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 86278333-86278398 [+]
sense
OTTHUMT00000393764 ; RP11-317J19.1-001; intron 2
ENST00000524610 ; RP11-317J19.1-001; intron 2
antisense
OTTHUMT00000393767 ; ME3-001; intron 1
OTTHUMT00000393769 ; ME3-003; intron 1
OTTHUMT00000393768 ; ME3-004; intron 2
OTTHUMT00000393770 ; ME3-002; intron 2
OTTHUMT00000393773 ; ME3-007; intron 2
ENST00000393324 ; ME3-001; intron 1
ENST00000530520 ; ME3-003; intron 1
ENST00000524826 ; ME3-004; intron 2
ENST00000526504 ; ME3-002; intron 2
ENST00000530335 ; ME3-007; intron 2
ENST00000359636 ; ME3-202; intron 2
ENST00000543262 ; ME3-203; intron 2
Database links

Mature sequence hsa-miR-6755-5p

Accession MIMAT0027410
Sequence

6 - 

uaggguagacacugacaacguu

 - 27

Get sequence
Deep sequencing38 reads, 12 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6755-3p

Accession MIMAT0027411
Sequence

45 - 

uguugucauguuuuuucccuag

 - 66

Get sequence
Deep sequencing9 reads, 9 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).