Stem-loop sequence hsa-mir-6754

AccessionMI0022599 (change log)
Symbol HGNC:MIR6754
DescriptionHomo sapiens miR-6754 stem-loop
Stem-loop
   gg    c   --     u   uu      ---   u 
5'   cugc agg  gaggc ggu  ggagga   guc g
     |||| |||  ||||| |||  ||||||   |||  
3'   gacg ucc  cuccg cca  ucucuu   cgg g
   --    -   gu     u   cu      guc   u 
Get sequence
Deep sequencing
51 reads, 0 reads per million, 33 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 71473503-71473568 [+]
sense
OTTHUMT00000394698 ; CTD-2313N18.2-001; intron 2
ENST00000527856 ; ENPP7P8-001; intron 2
Database links

Mature sequence hsa-miR-6754-5p

Accession MIMAT0027408
Sequence

6 - 

ccagggaggcugguuuggagga

 - 27

Get sequence
Deep sequencing13 reads, 11 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6754-3p

Accession MIMAT0027409
Sequence

44 - 

ucuucaccugccucugccugca

 - 65

Get sequence
Deep sequencing27 reads, 21 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).