Stem-loop sequence hsa-mir-6753

AccessionMI0022598 (change log)
Symbol HGNC:MIR6753
DescriptionHomo sapiens miR-6753 stem-loop
Stem-loop
   -----ca           -    g u  ucaucucacgucagagagaggggaaggggcugcccagugagcccccacagggcucu 
5'        ccagggcagag cagg c ga                                                        a
          ||||||||||| |||| | ||                                                         
3'        ggucccgucuc gucu g cu                                                        c
   gacccac           u    g u  ugccaccgcccccggaagucccugggacccuagaggucgguccgggucgaccucua 
Get sequence
Deep sequencing
121 reads, 13.6 reads per million, 59 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 68044794-68044957 [+]
intergenic
Database links

Mature sequence hsa-miR-6753-5p

Accession MIMAT0027406
Sequence

1 - 

caccagggcagagcagggcuga

 - 22

Get sequence
Deep sequencing27 reads, 21 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6753-3p

Accession MIMAT0027407
Sequence

139 - 

uggucugucucugcccuggcac

 - 160

Get sequence
Deep sequencing47 reads, 24 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).