Stem-loop sequence hsa-mir-6752

AccessionMI0022597 (change log)
Symbol HGNC:MIR6752
DescriptionHomo sapiens miR-6752 stem-loop
Stem-loop
   -au    ---       u     ca     ccc    c 
5'    ggag   gggggug ggagc  ggggg   aggu u
      ||||   ||||||| |||||  |||||   |||| a
3'    ccuc   cccccgu ccucg  ccccu   uucg c
   gac    aua       c     --     --c    a 
Get sequence
Deep sequencing
841 reads, 17.1 reads per million, 82 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 67490245-67490315 [+]
antisense
OTTHUMT00000393866 ; RP11-655M14.6-001; exon 1
ENST00000524910 ; RP11-655M14.6-001; exon 1
Database links

Mature sequence hsa-miR-6752-5p

Accession MIMAT0027404
Sequence

6 - 

gggggguguggagccagggggc

 - 27

Get sequence
Deep sequencing9 reads, 7 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6752-3p

Accession MIMAT0027405
Sequence

51 - 

ucccugcccccauacucccag

 - 71

Get sequence
Deep sequencing649 reads, 80 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).