Stem-loop sequence hsa-mir-6751

AccessionMI0022596 (change log)
Symbol HGNC:MIR6751
DescriptionHomo sapiens miR-6751 stem-loop
Literature search

1 open access papers mention hsa-mir-6751
(1 sentences)

Stem-loop
   ucuucuu     u      g u      c cc 
5'        ggggg gagguu g gucugg c  a
          ||||| |||||| | |||||| |   
3'        cucuc cuccga u cagacc g  g
   --gaccu     u      g -      c ac 
Get sequence
Deep sequencing
76 reads, 41.7 reads per million, 36 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 65129916-65129978 [-]
intergenic
Database links

Mature sequence hsa-miR-6751-5p

Accession MIMAT0027402
Sequence

6 - 

uugggggugagguuggugucugg

 - 28

Get sequence
Deep sequencing33 reads, 18 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6751-3p

Accession MIMAT0027403
Sequence

43 - 

acugagccucucucucuccag

 - 63

Get sequence
Deep sequencing43 reads, 25 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).