Stem-loop sequence hsa-mir-6750

AccessionMI0022595 (change log)
Symbol HGNC:MIR6750
DescriptionHomo sapiens miR-6750 stem-loop
Stem-loop
   gcuguca    a   cu       ----------     --   c 
5'        ggga cag  gggugag          cugcu  gcc c
          |||| |||  |||||||          |||||  ||| a
3'        cccu guc  cccacuc          gacga  cgg g
   -----ga    c   -u       aagaccugug     cc   a 
Get sequence
Deep sequencing
84 reads, 2 reads per million, 50 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 64898363-64898437 [-]
sense
OTTHUMT00000385280 ; SYVN1-014; intron 5
OTTHUMT00000385275 ; SYVN1-011; intron 8
OTTHUMT00000385276 ; SYVN1-003; intron 9
OTTHUMT00000385273 ; SYVN1-002; intron 10
OTTHUMT00000385274 ; SYVN1-001; intron 10
OTTHUMT00000385278 ; SYVN1-004; intron 10
ENST00000526121 ; SYVN1-014; intron 5
ENST00000307289 ; SYVN1-011; intron 8
ENST00000449943 ; SYVN1-003; intron 9
ENST00000294256 ; SYVN1-002; intron 10
ENST00000377190 ; SYVN1-001; intron 10
ENST00000526060 ; SYVN1-004; intron 10
Clustered miRNAs
< 10kb from hsa-mir-6750
hsa-mir-6749chr11: 64902387-64902455 [-]
hsa-mir-6750chr11: 64898363-64898437 [-]
hsa-mir-194-2chr11: 64891355-64891439 [-]
hsa-mir-192chr11: 64891137-64891246 [-]
Database links

Mature sequence hsa-miR-6750-5p

Accession MIMAT0027400
Sequence

6 - 

cagggaacagcugggugagcugcu

 - 29

Get sequence
Deep sequencing53 reads, 34 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6750-3p

Accession MIMAT0027401
Sequence

55 - 

gaacucacccucugcucccag

 - 75

Get sequence
Deep sequencing26 reads, 21 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).