Stem-loop sequence hsa-mir-6749

AccessionMI0022594 (change log)
Symbol HGNC:MIR6749
DescriptionHomo sapiens miR-6749 stem-loop
Stem-loop
   ggcccuc     u  g uu        uc  uccug 
5'        gggcc gg g  gggggagc  ug     u
          ||||| || |  ||||||||  ||      
3'        cccgg cc u  ccuccucg  ac     c
   -----ga     u  g cc        uu  ucacu 
Get sequence
Deep sequencing
68 reads, 7.89 reads per million, 38 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 64902387-64902455 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-6749
hsa-mir-6749chr11: 64902387-64902455 [-]
hsa-mir-6750chr11: 64898363-64898437 [-]
Database links

Mature sequence hsa-miR-6749-5p

Accession MIMAT0027398
Sequence

6 - 

ucgggccugggguugggggagc

 - 27

Get sequence
Deep sequencing18 reads, 16 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6749-3p

Accession MIMAT0027399
Sequence

49 - 

cuccuccccugccuggcccag

 - 69

Get sequence
Deep sequencing27 reads, 17 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).