Stem-loop sequence hsa-mir-6747

AccessionMI0022592 (change log)
Symbol HGNC:MIR6747
DescriptionHomo sapiens miR-6747 stem-loop
Stem-loop
   uuuggagg    ug  aa       aacauuc 
5'         ggug  ga  gaggcag       g
           ||||  ||  |||||||       u
3'         ccac  cu  uuccguc       u
   ------ga    gu  cc       cuuucac 
Get sequence
Deep sequencing
250 reads, 5.26 reads per million, 57 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 62567011-62567071 [-]
sense
OTTHUMT00000395369 ; NXF1-011; intron 2
OTTHUMT00000395368 ; NXF1-009; intron 4
OTTHUMT00000395364 ; NXF1-006; 3'UTR (exon 10)
OTTHUMT00000395365 ; NXF1-001; intron 11
OTTHUMT00000395367 ; NXF1-003; intron 11
ENST00000526163 ; NXF1-011; intron 2
ENST00000531579 ; NXF1-009; intron 4
ENST00000531709 ; NXF1-006; 3'UTR (exon 10)
ENST00000294172 ; NXF1-201; intron 10
ENST00000532297 ; NXF1-001; intron 11
ENST00000530875 ; NXF1-003; intron 11
Database links

Mature sequence hsa-miR-6747-5p

Accession MIMAT0027394
Sequence

6 - 

agggguguggaaagaggcagaaca

 - 29

Get sequence
Deep sequencing43 reads, 19 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6747-3p

Accession MIMAT0027395
Sequence

41 - 

uccugccuuccucugcaccag

 - 61

Get sequence
Deep sequencing206 reads, 45 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).