Stem-loop sequence hsa-mir-6746

AccessionMI0022591 (change log)
Symbol HGNC:MIR6746
DescriptionHomo sapiens miR-6746 stem-loop
Literature search

1 open access papers mention hsa-mir-6746
(1 sentences)

Stem-loop
   cuugcccg     -   a      c      g u 
5'         ggaga agg gguggc uggaga c g
           ||||| ||| |||||| |||||| |  
3'         ccucu ucc ccgccg accucu g c
   ----gaca     g   g      -      - u 
Get sequence
Deep sequencing
74 reads, 2.08 reads per million, 48 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 61878216-61878278 [-]
intergenic
Database links

Mature sequence hsa-miR-6746-5p

Accession MIMAT0027392
Sequence

6 - 

ccgggagaaggagguggccugg

 - 27

Get sequence
Deep sequencing36 reads, 29 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6746-3p

Accession MIMAT0027393
Sequence

42 - 

cagccgccgccugucuccacag

 - 63

Get sequence
Deep sequencing29 reads, 13 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).