Stem-loop sequence hsa-mir-6745

AccessionMI0022590 (change log)
Symbol HGNC:MIR6745
DescriptionHomo sapiens miR-6745 stem-loop
Stem-loop
   gguccuugagggca     ug gu   ggga  gauug  -     u    agcccugggucuagcagccuau 
5'               ggagc  g  cuu    cu     cc ccuag ggcu                      g
                 |||||  |  |||    ||     || ||||| ||||                      g
3'               ucuug  c  gaa    ga     gg ggguc cuga                      c
   ------------ac     gu ug   ----  ----a  u     -    gguggucacaaauggucuguga 
Get sequence
Deep sequencing
180 reads, 0 reads per million, 55 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 47179611-47179737 [-]
antisense
OTTHUMT00000391423 ; C11orf49-020; intron 4
OTTHUMT00000391363 ; C11orf49-018; intron 5
OTTHUMT00000391365 ; C11orf49-017; intron 5
OTTHUMT00000391420 ; C11orf49-021; intron 5
OTTHUMT00000391225 ; C11orf49-004; intron 6
OTTHUMT00000391227 ; C11orf49-005; intron 6
OTTHUMT00000391218 ; C11orf49-002; intron 7
OTTHUMT00000391220 ; C11orf49-003; intron 7
OTTHUMT00000391221 ; C11orf49-006; intron 7
OTTHUMT00000391223 ; C11orf49-007; intron 7
OTTHUMT00000391216 ; C11orf49-001; intron 8
ENST00000534581 ; C11orf49-020; intron 4
ENST00000527234 ; C11orf49-018; intron 5
ENST00000534249 ; C11orf49-017; intron 5
ENST00000526827 ; C11orf49-021; intron 5
ENST00000525895 ; C11orf49-004; intron 6
ENST00000527784 ; C11orf49-005; intron 6
ENST00000543718 ; C11orf49-202; intron 6
ENST00000278460 ; C11orf49-002; intron 7
ENST00000378618 ; C11orf49-003; intron 7
ENST00000395460 ; C11orf49-006; intron 7
ENST00000378615 ; C11orf49-007; intron 7
ENST00000528488 ; C11orf49-001; intron 8
ENST00000536126 ; C11orf49-201; intron 8
Database links

Mature sequence hsa-miR-6745

Accession MIMAT0027391
Sequence

103 - 

uggguggaagaaggucugguu

 - 123

Get sequence
Deep sequencing32 reads, 22 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).