Stem-loop sequence hsa-mir-6744

AccessionMI0022589 (change log)
Symbol HGNC:MIR6744
DescriptionHomo sapiens miR-6744 stem-loop
Stem-loop
   ucac  -         u        -----     a 
5'     gu ggaugacag ggaggccu     ccugg u
       || ||||||||| ||||||||     |||||  
3'     cg ccuacuguu ucuccggg     ggauc c
   --ga  u         c        acucu     u 
Get sequence
Deep sequencing
27 reads, 0 reads per million, 17 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 1256605-1256670 [+]
sense
OTTHUMT00000390040 ; MUC5B-001; exon 23
OTTHUMT00000390041 ; MUC5B-002; 3'UTR (exon 23)
ENST00000525715 ; MUC5B-001; exon 23
ENST00000529681 ; MUC5B-002; 3'UTR (exon 23)
ENST00000447027 ; MUC5B-201; 3'UTR (exon 23)
Database links

Mature sequence hsa-miR-6744-5p

Accession MIMAT0027389
Sequence

6 - 

uggaugacaguggaggccu

 - 24

Get sequence
Deep sequencing12 reads, 7 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6744-3p

Accession MIMAT0027390
Sequence

44 - 

gggccucucuugucauccugcag

 - 66

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).