Stem-loop sequence hsa-mir-6743

AccessionMI0022588 (change log)
Symbol HGNC:MIR6743
DescriptionHomo sapiens miR-6743 stem-loop
Literature search

1 open access papers mention hsa-mir-6743
(5 sentences)

Stem-loop
   ggguaaag         --c       -  --    aag 
5'         gggcaggga   ggguggc cc  cagg   a
           |||||||||   ||||||| ||  ||||    
3'         cccgucccu   cucgccg gg  gucc   a
   ----gaca         cuu       a  ug    ggg 
Get sequence
Deep sequencing
121 reads, 0 reads per million, 62 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 209336-209406 [+]
sense
OTTHUMT00000384762 ; RIC8A-003; 3'UTR (exon 1)
OTTHUMT00000385359 ; RIC8A-008; intron 1
OTTHUMT00000384761 ; RIC8A-002; intron 2
OTTHUMT00000239282 ; RIC8A-001; intron 2
OTTHUMT00000385355 ; RIC8A-009; intron 2
OTTHUMT00000385356 ; RIC8A-005; intron 2
OTTHUMT00000385357 ; RIC8A-007; exon 2
OTTHUMT00000385358 ; RIC8A-006; intron 2
ENST00000527696 ; RIC8A-003; 3'UTR (exon 1)
ENST00000527468 ; RIC8A-008; intron 1
ENST00000526104 ; RIC8A-002; intron 2
ENST00000325207 ; RIC8A-001; intron 2
ENST00000528357 ; RIC8A-009; intron 2
ENST00000526982 ; RIC8A-005; intron 2
ENST00000532373 ; RIC8A-007; exon 2
ENST00000530889 ; RIC8A-006; intron 2
Database links

Mature sequence hsa-miR-6743-5p

Accession MIMAT0027387
Sequence

6 - 

aaggggcagggacggguggccc

 - 27

Get sequence
Deep sequencing7 reads, 7 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6743-3p

Accession MIMAT0027388
Sequence

48 - 

agccgcucuucucccugcccaca

 - 70

Get sequence
Deep sequencing45 reads, 26 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).