Stem-loop sequence hsa-mir-6742

AccessionMI0022587 (change log)
Symbol HGNC:MIR6742
DescriptionHomo sapiens miR-6742 stem-loop
Stem-loop
   gaggg  u    u g       c     --  c 
5'      ag gggg g gacccag uguug  gc a
        || |||| | ||||||| |||||  ||  
3'      uc cccc u uuggguc acaac  cg u
   ---ga  u    - g       c     ag  g 
Get sequence
Deep sequencing
82 reads, 0 reads per million, 19 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 228397048-228397109 [-]
sense
OTTHUMT00000095982 ; C1orf145-001; intron 1
OTTHUMT00000095984 ; C1orf145-003; intron 1
OTTHUMT00000095983 ; C1orf145-002; intron 3
ENST00000295012 ; C1orf145-001; intron 1
ENST00000472613 ; C1orf145-003; intron 1
ENST00000337335 ; C1orf145-002; intron 3
antisense
OTTHUMT00000095986 ; OBSCN-001; intron 1
OTTHUMT00000421354 ; OBSCN-011; intron 1
ENST00000284548 ; OBSCN-001; intron 1
ENST00000570156 ; OBSCN-011; intron 1
ENST00000422127 ; OBSCN-204; intron 1
ENST00000366707 ; OBSCN-202; intron 1
ENST00000366709 ; OBSCN-203; intron 1
Database links

Mature sequence hsa-miR-6742-5p

Accession MIMAT0027385
Sequence

6 - 

aguggggugggacccagcuguu

 - 27

Get sequence
Deep sequencing28 reads, 8 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6742-3p

Accession MIMAT0027386
Sequence

43 - 

accuggguuguccccucuag

 - 62

Get sequence
Deep sequencing54 reads, 14 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).