Stem-loop sequence hsa-mir-6741

AccessionMI0022586 (change log)
Symbol HGNC:MIR6741
DescriptionHomo sapiens miR-6741 stem-loop
Literature search

1 open access papers mention hsa-mir-6741
(5 sentences)

Stem-loop
   aau       ugcu  u        -------u  c 
5'    ggguggg    gg gggagccg        gc c
      |||||||    || ||||||||        ||  
3'    cccacuc    cc cucucggc        cg u
   gau       ----  u        uuacucac  g 
Get sequence
Deep sequencing
119 reads, 0 reads per million, 44 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 225922080-225922142 [-]
sense
OTTHUMT00000092058 ; RP11-145A3.2-001; intron 2
ENST00000428148 ; RP11-145A3.2-001; intron 2
antisense
OTTHUMT00000092057 ; RP11-145A3.1-001; intron 1
ENST00000448264 ; RP11-145A3.1-001; intron 1
Database links

Mature sequence hsa-miR-6741-5p

Accession MIMAT0027383
Sequence

6 - 

gugggugcuggugggagccgug

 - 27

Get sequence
Deep sequencing44 reads, 25 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6741-3p

Accession MIMAT0027384
Sequence

42 - 

ucggcucucucccucacccuag

 - 63

Get sequence
Deep sequencing70 reads, 23 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).